Skip to main content

Table 1 Quantitative PCR primer sequences

From: Functional analysis of the impact of ORMDL3 expression on inflammation and activation of the unfolded protein response in human airway epithelial cells

Gene NCBI accession Forward (5 → 3) Reverse (5 → 3) CDS region Product size
GAPDH NM_002046.4 GCACCGTCAAGGCTGAGAACGG CGACGTACTCAGCGCCAGCATC c.173-286 114
PPIA NM_021130 TAAAGCATACGGGTCCTGGCATCT ATCCAACCACTCAGTCTTGGCAGT c.269-369 101
ACTB NM_001101.3 GTTGCGTTACACCCTTTCTT ACCTTCACCGTTCCAGTTT c.*16-*162 147
DDIT3 NM_001195053.1 GAAATGAAGAGGAAGAATCA TTCTCCTTCATGCGCT c.197-437 241
XBP-1s NM_001079539.1 ATGGATGCCCTGGTTGCTGAAGA TGCACCTGCTGCGGACTCA c.415-504 90
XBP-1u NM_005080.3 AGCACTCAGACTACGTGCACCTCT CCAGAATGCCCAACAGGATATCAG c.495-624 130
ORMDL1 NM_016467.4 AATGGCTGGTCCTTCAAGTGCT ACCCTCACTGTGATGCCCTTTA c.*121-*269 149
ORMDL2 NM_014182.4 ACACACTGGGAGCAAATGGACT AGTGCGCAGCATCATACTTGGT c.250-370 121
ORMDL3 NM_139280.2 TCAGGCAGCCAAAGCACTTTAACC ACCCATCCCACACTTGCTTCCATA c.*358-*496 139
BCL6 NM_001706.4 ACAATCCCAGAAGAGGCACGAAGT GCTCGAAATGCAGGGCAATCTCAT c.790-952 163
CCL2 NM_002982.3 TCGCTCAGCCAGATGCAATCAATG TGGAATCCTGAACCCACTTCTGCT c.65-259 195
CCL5 NM_002985.2 TGCCTGTTTCTGCTTGCTCTTGTC TGTGGTAGAATCTGGGCCCTTCAA c.*36-*127 92
CSF2 NM_000758.3 AAATGTTTGACCTCCAGGAGCCGA GGTGATAATCTGGGTTGCACAGGA c.185-357 173
IL12A NM_000882.3 ATGATGGCCCTGTGCCTTAGTAGT AGGGCCTGCATCAGCTCATCAATA c.457-611 155
IL13RA1 NM_001560.2 GTCCCAGTGTAGCACCAATGA CAGTCACAGCAGACTCAGGAT c.297-391 95
ADRB2 NM_000024.5 TCATCATGGGCACTTTCACCCTCT AGCTCCTGGAAGGCAATCCTGAAA c.830-1016 187
VEGFA NM_001025366.2 TTCAGGACATTGCTGTGCTTTGGG TGGGCTGCTTCTTCCAACAATGTG c.*778-*969 192
IL23A NM_016584.2 TCGGTGAACAACTGAGGGAACCAA TGGAATCTCTGCCCACTTCCACTT c.-140- -54 87
  1. c.-number if in the 5UTR, c.*number if in the 3UTR.