Skip to main content

Table 1 Used primers sequences

From: The effect of Co-Q10 on allergic rhinitis and allergic asthma

Gene 5′-3′ Primer
COX-2 Forward ACCAGCAGTTCCAGTATCAGA
Reverse CAGGAGGATGGAGTTGTTGTAG
CCL24 Forward AGGCAGTGAGAACCAAGT
Reverse GCGTCAATACCTATGTCCAA
CCL11 Forward GGCTTCATGTAGTTCCAGAT
Reverse CCATTGTGTTCCTCAATAATCC
Nrf2 Forward TCTCCTCGCTGGAAAAAGAA
Reverse AATGTGCTGGCTGTGCTTTA
Eotaxin Forward CTGCTCACGGTCACTTCCTT
Reverse GGGGTCAGCACAGATCTCTT
GAPDH Forward TGTTCCTACCCCCAATGTGT
Reverse GGTCCTCAGTGTAGCCCAAG
Actb Forward AGAAGCTGTGCTATGTTGCTCTA
Reverse TCAGGCAGCTCATAGCTCTTC
ND1 Forward ATTACTTCTGCCAGCCTGACC
Reverse GGCCCGGTTTGTTTCTGCTA
Cytb Forward GGCTACGTCCTTCCATGAGG
Reverse TGGGATGGCTGATAGGAGGT
COX1 Forward ATCACTACCAGTGCTAGCCG
Reverse CCTCCAGCGGGATCAAAGAA