Skip to main content

Table 1 Primers used in this study

From: MicroRNA-29 mediates anti-inflammatory effects and alleviation of allergic responses and symptoms in mice with allergic rhinitis

Gene   Primers sequences (5′-3′)
miR-29 Forward CTGAGTTTCTATTTAGACACTACAACA
  Reverse ACAATTTGACATGTGGCATTAACG
IL-4 Forward TGTACCAGGAGCCATATCCA
  Reverse TGTTCTTCGTTGCTGTGAGG
IL-6 Forward TCTCTGATGCTGTTGCTGCT
  Reverse CGTGGAACGGTTGAGGTAGT
IL-10 Forward TACAACAGCCAGCCAAACAG
  Reverse CACCCTTCAAACCCTTCCTC
IFN-γ Forward CTGCTGATGGGAGGAGATGT
  Reverse TTTGTCATTCGGGTGTAGTCA
Cleaved caspase-3 Forward TACCACCTATCCGCCCTATG
  Reverse GCCTCGACTTACATCCGAAC
U6 Forward GCTTCGGCAGCACATATACTAAAAT
  Reverse CGCTTCACGAATTTGCGTGTCAT
β-actin Forward GCAGAAGGAGATTACTGCTCT
  Reverse GCTGATCCACATCTGCTGGAA