- Letter to the editor
- Open Access
- Published:
Exome sequencing enables diagnosis of X-linked hypohidrotic ectodermal dysplasia in patient with eosinophilic esophagitis and severe atopy
Allergy, Asthma & Clinical Immunology volume 17, Article number: 9 (2021)
Abstract
X-linked hypohidrotic ectodermal dysplasia (XLHED) is the most common form of ectodermal dysplasia. Clinical and genetic heterogeneity between different ectodermal dysplasia types and evidence of incomplete penetrance and variable expressivity increase the potential for misdiagnosis. We describe a family with X-linked hypohidrotic ectodermal dysplasia (XLHED) presenting with variable expressivity of symptoms between affected siblings. In addition to the classical signs of hypohidrosis, hypotrichosis and hypodontia, the index patient—a 5 year old boy, also presented with a severe atopy phenotype that was not observed in the other two affected brothers. Exome sequencing in the index and the mother identified a pathogenic nonsense variant in EDA (NM_001399.4: c.766 C>T; p. Gln256Ter). This study highlights how exome sequencing was crucial in establishing a precise molecular diagnosis of XLHED by enabling us to rule out other differential diagnoses including NEMO deficiency syndrome, that was initially presented as a clinical diagnosis to the family.
Introduction
Ectodermal dysplasias (EDs) are a group of clinically and genetically heterogeneous disorders characterized by abnormal development of two or more ectodermal structures including teeth, hair, skin, nails, sebaceous glands and other eccrine glands [1]. Amongst a collective group of more than 200 different types of EDs, the hypohidrotic form of ED (HED) is the most common. HEDs are caused by mutations in one of several genes (i.e. genetic heterogeneity) encoding components of the ectodysplasin A (EDA) signaling pathway crucial in embryonic ectodermal development (Fig. 1).
EDA signaling pathway. The trimeric EDA ligand binds to the trimeric EDAR receptor and recruits the adaptor EDARADD, which then forms a complex with TRAF6, TAB2 and TAK1. This results in activation of the IKK complex via TAK1. The activated IKK complex (NEMO, IKK1 and IKK2) ubiquitinates IκB, thereby releasing NF-κB, which can translocates into the nucleus to activate transcription of target genes. The pathway represents protein names and symbols. The HGNC gene symbols are as follows: EDA (EDA-A1), EDAR (EDAR), EDARADD (EDARADD), TRAF6 (TRAF6), MAP3K7 (TAK1), TAB2 (TAB2), CHUK (IKK1), IKBKB (IKK2), IKBKG (NEMO), NFKB1A (IκB), NFKB1 (NF-κB). The different ED types caused by variants in different genes in the EDA signaling pathway are described in red text on the right. Figure [14]
HED typically follows one of three possible inheritance patterns: the X-linked form is caused by variants in EDA (MIM: 300451) encoding the ligand ectodysplasin A-A1; the autosomal recessive and autosomal dominant forms are caused by variants in the EDA receptor encoded by EDAR (MIM: 604095) and in the EDAR-associated death domain which is encoded by EDARADD (MIM: 606603) (Fig. 1). Of these, X-linked hypohidrotic ectodermal dysplasia (XLHED) is the most common phenotype occurring in one per 17,000 live births and is distinguished from other ED types by a triad of classical signs—hypohidrosis (reduced ability to sweat), hypotrichosis (sparse thinning hair) and pointed teeth or lack of several teeth (hypodontia or anodontia). While affected hemizygous males are most severely impacted showing the classical trio of signs, heterozygous female carriers display variable expressivity without symptoms or only moderately affected features such as uneven distribution of sweating and defective dentition [1, 2].
Without molecular tests, the clinical and genetic heterogeneity associated with EDs makes diagnosis and management challenging. Incomplete penetrance and variable expression, sometimes even between members of the same family, illustrate the lack of clear genotype–phenotype relationships [3, 4]. Differential diagnoses often include disorders caused by variants in genes belonging to the same pathway presenting with overlapping clinical symptoms. Most notable in this regard are genes downstream of EDA signaling in the TNF-α pathway that lead to NF-κB activation. Variants in IKBKG (MIM: 300248; also known as NEMO) lead to syndromic features with symptoms of incontinentia pigmenti or classical HED accompanied by immunodeficiency (HED-ID) and/ or osteopetrosis and lymphedema (HED-ID-OL). Because of the associated clinical heterogeneity and variable expression, it is not possible to phenotypically distinguish these disorders from classical HED with certainty [5]. Besides, lack of a genetic diagnosis means the opportunity for appropriate genetic counseling and risk assessment in family members is missed.
Case report
We report the application of Whole Exome Sequencing (WES) for the ultimate diagnosis of XLHED in a family due to a pathogenic nonsense EDA variant (Fig. 2a). The index is a 5-year-old male (III-4) presenting with classical HED signs including sparse thin hair, hypodontia and/ or pointed teeth and overheating with an inability to sweat. In addition, the index is affected by severe atopy with eosinophilic esophagitis. His atopic diathesis is characterized by multiple IgE-mediated food allergies, asthma, allergic rhinoconjunctivitis and severe atopic dermatitis. Additional details about the atopy features in the index and their management are presented in Table 1. The mother (II-2) has a milder HED phenotype (without atopy) presenting with pointed teeth and mild overheating with somewhat reduced sweating. The index's two male siblings (III-1, III-2) show similar HED symptoms (without any atopy) while a female sibling (III-3) is unaffected. The index’s maternal grandfather (I-1) is also reported to be affected.
Family pedigree and the EDA c.766C > T (p.Q256*) variant. a Family pedigree. b Sanger sequencing of whole blood from the male index patient (III-4), the mother (II-2) and a healthy female control showing that the index (III-4) is hemizygous for the EDA c.766C > T variant whereas the mother (II-2) is heterozygous. The female healthy control shown here is homozygous for the reference allele. c Representative structure of the EDA protein (full-length EDA-A1 isoform with 391 amino acids) showing the position of the p.Q256* variant within the TNF domain
A possible clinical diagnosis of NEMO deficiency ED initially triggered referral of the index patient to clinical immunology because of his history of infections; including recurrent Group A streptococcal skin infections requiring multiple courses of antibiotics and episodes of oral candidiasis. Although it is important to emphasize that increased susceptibility to pyogenic bacteria, viruses and nonpathogenic mycobacterial infections are the classic features of NEMO deficiency ED [6]. However, WES in the index and the mother identified a previously known pathogenic nonsense variant (Clinvar Accession: VCV000177947.1) in the EDA gene [NM_001399.4: c.766 C > T; NP_001390: p. Gln256Ter; rs727504417]. The index is hemizygous for the variant and the mother is heterozygous for the variant. Subsequent Sanger sequencing confirmed these findings (Fig. 2b). The variant results in a premature translational stop signal at amino acid position 256 in the TNF (Tumor Necrosis Factor) homology domain and is predicted to result in an absent or truncated protein product (Fig. 2c). The C-terminal TNF homology domain is the receptor binding domain of the protein and mutations in this domain are known to impair binding of both EDA protein isoforms (EDA-A1 and EDA-A2) to their receptors. Identification of the pathogenic EDA nonsense variant had a number of clinical benefits for the family including ending their search for a diagnosis, advice on avoiding complications of hyperthermia, informing future specialty assessments, reproductive counseling, and reassurance that prognosis for normal growth, development, and lifespan is excellent.
Discussion
The presence of atopic symptoms in the index patient raised the question of whether these additional clinical features are a phenotypic expansion underlying the variable expressivity associated with EDs or whether they indicate an additional differential diagnosis in the index. In order to rule out the possibility of any competing or secondary diagnoses in the index patient, we specifically looked for damaging variants in genes that could lead to NEMO deficiency ED (IKBKG) or primary atopic disorders with significant skin involvement and multiple allergies such as those caused by damaging variants in FLG, DSP, DSG1 and SPINK5, but did not identify any clinically relevant variants [7]. While a secondary diagnosis cannot be completely ruled out considering the limitations of WES and the possibility of variants in non-coding regions or genes associated with primary atopic disorders that are currently unknown, we believe that the severe atopy seen in the index patient is likely secondary to his ectodermal dysplasia.
Two different studies performing retrospective analysis of individuals with hypohidrotic/anhidrotic ectodermal dysplasias have reported that these individuals have a significantly increased prevalence of atopic disorders compared to the general population [8, 9]. The study by Guazzarotti et al. investigated the phenotypic spectrum in 45 Italian male subjects with molecularly confirmed XLHED and found that 71.1% showed at least one allergic manifestation. However, only 3% of the patients had food allergy and none had eosinophilic esophagitis [8]. Similarly, a retrospective survey-based study of 347 families who were members of the National Foundation for Ectodermal Dysplasias found greater reported prevalence of symptoms suggestive of atopic disorders among children with ED syndromes than the general pediatric population [9]. Several other case reports of HED patients presenting with signs of allergic disease also support these findings [10, 11]. Though the specific mechanism(s) underlying the increased susceptibility and development of allergic disease in ectodermal dysplasias is unclear, disruption and dysfunction of the skin barrier are generally considered to contribute to the pathogenesis [7].
Conclusion
In conclusion, we report a case of XLHED that presented with classical HED signs of hypohidrosis, hypotrichosis and hypodontia as well as severe atopy. These findings emphasize the variable expressivity of XLHED between affected individuals, in this case within the same family. They highlight the need for in-depth evaluation and reporting of clinical features to expand our understanding of the phenotypic spectrum associated with XLHED. We would like to draw attention of health care practitioners and researchers in allergy, asthma and clinical immunology to the importance of applying unbiased genetic testing modalities like whole exome sequencing towards the diagnosis of patients that present with vast phenotypic heterogeneity or unusual severity of certain symptoms. By presenting an accurate molecular diagnosis to the family, we can now provide them with an answer to better understand their medical condition as well as its genetic implications—steps toward a personalized medicine approach with accurate genetic counselling and tailored clinical management.
Methods
Subjects
The family was enrolled into the GARD (Genetic Alterations in Rare Diseases) research study (UBC IRB approval H09-01,228). Informed written consent was obtained from the index patient and the mother for their participation in the study, sample collection, whole exome sequencing, data analysis and publication of findings.
Sequencing and genomic analysis
Genomic DNA was isolated from peripheral blood using standard protocols and exome sequencing for the mother and the index patient was performed on an Illumina platform. Exome Sequencing data was analyzed using an updated version of our in-house, open-source, semi-automated bioinformatics pipeline that has been previously described. [12, 13] Once a candidate variant list was generated by the pipeline, variants identified through the X-linked inheritance models were first assessed as the family pedigree was strongly suggestive of an X-linked inheritance pattern. Next, the candidate variant list was screened for variants in IKBKG (to rule out NEMO deficiency) as well as primary atopic disorder genes. In addition, a phenotype-driven approach was also employed to identify variants in genes that may be associated with clinical features such as eczema, allergy, asthma, dermatitis, atopy (associated MeSH and HPO terms) present in the index patient.
Confirmation of the EDA variant identified through exome sequencing in the index patient and the mother was done using Sanger sequencing.
Primer sequences
F: 5′ TCCCTTGCTACAGCTGTGTG 3′
R: 5′ CGTATGCCAACGGTACCTCA 3′
Availability of data and materials
Not applicable.
Abbreviations
- DSG1:
-
Desmoglein 1
- DSP:
-
Desmoplakin
- ED:
-
Ectodermal dysplasia
- EDA:
-
Ectodysplasin A
- EDAR:
-
EDA receptor
- EDARADD:
-
EDAR-associated death domain
- ES:
-
Exome sequencing
- FLG:
-
Filaggrin
- IKBKG:
-
Inhibitor of nuclear factor kappa B kinase regulatory subunit gamma
- NEMO:
-
NF-κB essential modulator
- NF-κB:
-
Nuclear factor kappa B
- SPINK5:
-
Serine peptidase inhibitor Kazal Type 5
- TNF:
-
Tumor necrosis factor
- XLHED:
-
X-linked hypohidrotic ectodermal dysplasia
References
- 1.
Reyes-Reali J, et al. Hypohidrotic ectodermal dysplasia: clinical and molecular review. Int J Dermatol. 2018. https://doi.org/10.1111/ijd.14048.
- 2.
Trzeciak WH, Koczorowski R. Molecular basis of hypohidrotic ectodermal dysplasia: an update. J Appl Genet. 2016. https://doi.org/10.1007/s13353-015-0307-4.
- 3.
Burger K, et al. Genotype-phenotype correlation in boys with X-linked hypohidrotic ectodermal dysplasia. Am J Med Genet Part A. 2014. https://doi.org/10.1002/ajmg.a.36541.
- 4.
Kobielak K, et al. Mutations in the EDA gene in three unrelated families reveal no apparent correlation between phenotype and genotype in the patients with an X-linked anhidrotic ectodermal dysplasia. Am J Med Genet. 2001. https://doi.org/10.1002/ajmg.1225.
- 5.
Fusco F, et al. EDA-ID and IP, Two Faces of the Same Coin: How the Same IKBKG / NEMO Mutation Affecting the NF-B Pathway Can Cause Immunodeficiency and/or Inflammation. Int Rev Immunol. 2015. https://doi.org/10.3109/08830185.2015.1055331.
- 6.
Orange JS, et al. The presentation and natural history of immunodeficiency caused by nuclear factor κB essential modulator mutation. J Allergy Clin Immunol. 2004. https://doi.org/10.1016/j.jaci.2004.01.762.
- 7.
Lyons JJ, Milner JD. Primary atopic disorders. J Exp Med. 2018. https://doi.org/10.1084/jem.20172306.
- 8.
Guazzarotti L, et al. Phenotypic heterogeneity and mutational spectrum in a cohort of 45 Italian males subjects with X-linked ectodermal dysplasia. Clin Genet. 2015. https://doi.org/10.1111/cge.12404.
- 9.
Mark BJ, et al. Prevalence of atopic disorders and immunodeficiency in patients with ectodermal dysplasia syndromes. Ann Allergy Asthma Immunol. 2012;1:1. https://doi.org/10.1016/j.anai.2012.04.010.
- 10.
Suzuki T, et al. A case of anhidrotic ectodermal dysplasia presenting with pyrexia, atopic eczema, and food allergy. Asia Pac Allergy. 2019. https://doi.org/10.5415/apallergy.2019.9.e3.
- 11.
Koguchi-Yoshioka H, et al. Atopic diathesis in hypohidrotic/anhidrotic ectodermal dysplasia. Acta Derm Venereol. 2015. https://doi.org/10.2340/00015555-1978.
- 12.
Tarailo-Graovac M, et al. Exome sequencing and the management of neurometabolic disorders. N Engl J Med. 2016. https://doi.org/10.1056/NEJMoa1515792.
- 13.
van Kuilenburg ABP, et al. Glutaminase deficiency caused by short tandem repeat expansion in GLS. N Engl J Med. 2019;380:1433–41.
- 14.
Sadier A, Viriot L, Pantalacci S, Laudet V. The ectodysplasin pathway: from diseases to adaptations. Trends Genet. 2014. https://doi.org/10.1016/j.tig.2013.08.006.
Acknowledgements
We thank the patients and their families for participating in this study. We also thank Lauren Muttucomaroe for enrollment of patients into the study and Valerie Tolsma for providing study administration and logistic support.
Funding
Funding for this work was received from Genome British Columbia − SIP007. SET is supported by a Tier 1 Canada Research Chair in Pediatric Precision Health.
Author information
Affiliations
Contributions
BPM analyzed the exome sequencing data, contributed to the molecular diagnosis and designed the report. KDB, SL and MS performed the molecular studies (DNA extraction, Sanger sequencing and analysis). PAR, CDK and WWW contributed to the bioinformatics pipeline used for the analysis of the exome sequencing data. CMB, ESC and SET contributed to the case presentation, diagnosis and clinical management of the family. BPM, KDB and SET prepared the first draft of the manuscript. All authors contributed to the review and editing of the final manuscript draft. All authors read and approved the final manscript.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
Research study protocols were approved by our institutional review board (H09-01228). Two members of the family (the affected child and his mother) were enrolled. Written informed consent for genetic testing and participation was provided by the mother for her child.
Consent for publication
Manuscript was shared with the family in advance of submission and legal guardian gave consent to proceed with publication.
Competing interests
VA has been a member of the advisory board for AVIR Pharma. ESC has received research support from DBV Technologies, has been a member of advisory boards for Pfizer, Pediapharm, Leo Pharma, Kaleo, DBV, is a member of the healthcare advisory board for Food Allergy Canada, was an expert panel and coordinating committee member of the National Institute of Allergy and Infectious Diseases (NIAID)-sponsored Guidelines for Peanut Allergy Prevention, is co-lead of the CSACI oral immunotherapy guidelines, and is a member of the committee for the American Gastroenterological Association & AAAAI/ACAAI Joint Task Force guidelines on the management of eosinophilic esophagitis.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Modi, B.P., Del Bel, K.L., Lin, S. et al. Exome sequencing enables diagnosis of X-linked hypohidrotic ectodermal dysplasia in patient with eosinophilic esophagitis and severe atopy. Allergy Asthma Clin Immunol 17, 9 (2021). https://doi.org/10.1186/s13223-021-00510-z
Received:
Accepted:
Published:
Keywords
- X-linked hypohidrotic ectodermal dysplasia
- EDA
- Atopy
- Exome sequencing